mscL [2018-11-01 18:17:09]

large conductance mechanosensitive channel protein, prevents selective release of cytoplasmic proteins in a hypotonic environment

locus: BSU36360

pI: 4.65

mw: 14.14 kDa

protein length: 130 aa

gene length: 390 bp

function: resistance to osmotic downshock, glycine betaine export

product: large conductance mechanosensitive channel protein

essential: no

synonyms: ywpC

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,743,267 → 3,743,659

Phenotypes of a mutant

• sensitive to osmotic downshock (> 0.5 M) during logarithmic growth [Pubmed|19252899]

The protein

Protein family

• mscL family (according to Swiss-Prot)

Structure

• [PDB|3HZQ] (MscL of ''Staphylococcus aureus'') [Pubmed|19701184]

[SW|Localization]

• cell membrane [Pubmed|19252899]

Expression and Regulation

Operons

• genes: [gene|BDA23FA513C240B07DC109BB62A7A5EB96B20965|ywpB]-[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]
  description: [Pubmed|22383849]

  regulation

  • expressed in logarithmic phase [Pubmed|19252899]

Biological materials

Mutant

• MGNA-A562 (ywpC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/562 NBRP B. subtilis, Japan]
• 1A957 ( ''mscL''::''spec''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A957&Search=1A957 BGSC]
• BKE36360 (Δ[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
• BKK36360 (Δ[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA

Labs working on this gene/protein

• [SW|Jan Maarten van Dijl], Groningen, Netherlands
• [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

References

Reviews

• 12626684,19727188,20825352,22685280,24258154,22685280,22404681,24607989,17505523

Original Publications

• 17665170,18310427,19160392,16897034,19252899,19701184,9632260,19738010,9353933